닫기
TaKaRa
로그인  |   회원가입  |   ID/PW 찾기   |  제품상담문의  
제품명/제품코드
키워드검색
검색
닫기
  • 고객지원센터 
  • 업무안내│학술지원
  • 전화번호│02-2081-2510
  • Email     │support@takara.co.kr
  • 대전지사 
  • 업무안내│대전/충청지역 주문, 학술지원
  • 전화번호│042-828-6525
  • Email     │tkbd@takara.co.kr
  • 업무시간안내
  • [ 평  일 ] 09 : 00 ~ 18 : 00 │ [ 점심시간 ] 12 : 00 ~ 13 : 00
  • 토·일요일, 공휴일은 휴무입니다.
Home > 전제품보기 > PCR > DNA PCR 관련 제품 > β-globin (human) Primer Set
PCR 용 Control Primer

β-globin (human) Primer Set

-

제조사 제품코드 제품명 용량 가격
(부가세별도)
비고 사용자매뉴얼
Takara
3868
β-globin (human) Primer set
관련학술 구매하기
500 pmol × 6
252,800원 
316,000원
가격할인
03.02 ~ 04.30
3868_DS.v1901Da.pdf

제품설명
Human genome DNA의 β-globin 영역을 PCR법으로 증폭하기 위 한 primer로 각 primer의 조합에 의해 9종류의 크기가 다른 단편을 증폭할 수 있다. 따라서 추출한 human genome DNA를 PCR법에 의해 증폭할 경우, 이 primer를 positive control로써 동시에 사용하 여 그 DNA가 PCR의 주형으로써 적당한지의 여부를 확인할 수 있다.
증폭단편의 길이 (bp)
Primer 서열
PC03(forward) d(ACACAACTGTGTTCACTAGC)
PC04 (reverse) d(CAACT TCATC CACGT TCACC)
GH20 (forward) d(GAAGA GCCAA GGACA GGTAC)
GH21 (reverse) d(GGAAA ATAGA CCAAT AGGCA G)
KM29 (forward) d(GGTTG GCCAA TCTAC TCCCA GG)
KM38 (forward) d(TGGTC TCCTT AAACC TGTCT TG)
형상
동결 건조품
(멸균 증류수 또는 TE Buffer에 용해하여 사용한다)
보존 -20℃
품질
- HPLC분석에 의해 순도의 확인을 실시하고 있다.
- PCR로 검정하고 있다.

Keyword :

DNA PCR 관련 제품
>
Hot spot 없이 Random하게 돌연변이를 도입할 ..
Diversify PCR Random Mutagenesis Kit
>
PCR 용 Control Primer
β-globin (human) Primer Set